VBQs Molecular Basis of Inheritance Class 12 Biology with solutions has been provided below for standard students. We have provided chapter wise VBQ for Class 12 Biology with solutions. The following Molecular Basis of Inheritance Class 12 Biology value based questions with answers will come in your exams. Students should understand the concepts and learn the solved cased based VBQs provided below. This will help you to get better marks in class 12 examinations.
Molecular Basis of Inheritance VBQs Class 12 Biology
Very Short Answer Type Questions
Question. Write the dual purpose served by Deoxyribonucleoside triphosphates in polymerization.
Answer : Acts as a substrate, provide energy (from the terminal two phosphates).
Question. Mention one difference to distinguish an exon from an intron.
Answer : Exon : Coded/expressed sequence of nucleotides in mRNA.
Intron : Intervening sequence of nucleotides not appearing in processed mRNA.
Detailed Answer :
The exons are the coding segments or sequences of mRNA while the intron are the non-coding segments or intervening nucleotide sequences of mRNA which are removed during splicing through processing of mRNA.
Question. Name the enzyme that transcribes hn-RNA in eukaryotes.
Answer : RNA Polymerase II.
Question. Name the negatively charged and positively charged components of a nucleosome.
Answer : Negatively charged component is DNA, positively charged component is histone octamer.
Question. Name the transcriptionally active region of chromatin in a nucleus.
Answer : Euchromatin i.e. lightly stained transcriptionally active region.
Question. Why is it not possible for an alien DNA to become a part of a chromosome anywhere along its length and replicate normally ?
Answer : This DNA must be linked to ori/origin of replication site to start replication.
Detailed Answer :
Alien DNA after becoming the part of chromosome anywhere will not be able to replicate normally because it requires a specific sequence of bases which constitute the ori (origin of replication), for starting replication within the host cell.
Question. Name the specific components and the linkage between them that form deoxyadenosine.
Answer : Components : Nitrogen base Adenine (a purine) +Deoxyribose sugar.
Linkage : N-Glycosidic linkage [C – N – C].
Question. Which of the two subunits of ribosome encounters an mRNA ?
Answer : The small subunit of ribosome encounters an mRNA.
Question. Name the specific components and the linkages between them that form deoxyguanosine.
Answer : Components : Deoxyribose sugar and nitrogen base guanine.
Linkage : N-glycosidic linkage.
Question. Name the enzyme and state its property that is responsible for continuous and discontinuous replication of the two strands of a DNA molecule.
Answer : DNA polymerase.
Because it has exonuclease activity in 5’ → 3’ direction.
Question. Name the enzyme involved in the continuous replication of DNA strand. Mention the polarity of the template strand.
Answer : DNA polymerase is involved in the continuous replication of DNA strand.
Polarity of the strand is 3’ → 5’.
Question. A region of a coding DNA strand has the following nucleotide sequence :
– ATGC –
What shall be the nucleotide sequence in (i) sister DNA segment it replicates, and (ii) m-RNA polynucleotide it transcribes ?
Answer : (i) – TACG – (ii) – UACG-
Question. Name the enzyme that helps to join DNA fragments.
Answer : DNA ligase joins/seal or stick the DNA fragments.
Short Answer Type Questions
Question. Discuss the role the enzyme DNA ligase plays during DNA replication.
Answer : (Discontinuous) DNA fragments, are joined/sealed by them//sticky ends of vector and foreign DNA, joined by them. The following diagram can be considered in lieu of explanation.
Detailed Answer :
The DNA ligase enzyme joins or seals the discontinuous fragments of DNA. It helps in joining the DNA strands together by catalysing the formation of phosphodiester bond. It also plays an important role in repairing the single strand break in DNA duplex. It also plays an important role in joining the discontinuously synthesized fragments of lagging strand (okazaki fragments) of DNA.
Question. State the functions of Ribozyme and release factor in protein synthesis respectively.
Answer : Ribozyme–helps in peptide bond formation.
Release factor–terminates translation/release polypeptide from ribosome.
Question. State the difference between the structural genes in a Transcription Unit of Prokaryotes and Eukaryotes.
Answer :
Detailed Answer :
In most eukaryotes, a structural gene codes for a single polypeptide i.e. it is monocistronic. Each gene in eukaryotes has exons and introns and is termed as split gene. Exons are coding sequences and introns are non coding which are removed by process of splicing while in most prokaryotes a structural gene codes for more than one polypeptide i.e. it is polycistronic.
Question. A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed along with their polarity.
3’ ATGCATGCATGCATGCATGCATGC 5’
Answer : Coding strand–
5′ TACGTACGTACGTACGTACGTACG 3’ mRNA strand–
5′ UACGUACGUACGUACGUACGUACG 3’
Question. Draw a schematic diagram of a part of double stranded dinucleotide DNA chain having all the four nitrogenous bases and showing the correct polarity.
Answer :
Question. State the dual role of deoxyribonucleoside triphosphates during DNA replication.
Answer : The dual role of deoxyribonucleoside triphosphates are:
1. It serves are substrates for DNA synthesis
2. It provides energy for polymerisation reaction.
Question. Make a labelled diagram of an RNA dinucleotide showing its 3’ –5’ polarity.
Answer : Labelled diagram of RNA dinucleotide showing its 3′ – 5′ polarity is as follows :
Question. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain.
Answer : DNA is negatively charged, positively charged protein, holds it in place, in large loops (in a region termed as nucleiod).
Detailed Answer:
In prokaryotic cell, the DNA is not scattered throughout the cell but present in the form of a membrane less structure called nucleoid. The prokaryotic cells uses a specific mechanism to pack the genetic material tightly into this region.
The prokaryotic cell do take up a measure against this by folding the fibers and forming genophore.